blob: 774a7f1d789cbdf76502342463035cee6244e44c [file] [log] [blame]
<html>
<head>
<script src="../htmlrunner.js"></script>
<script>
// The Great Computer Language Shootout
// http://shootout.alioth.debian.org
//
// Contributed by Ian Osgood
var last = 42, A = 3877, C = 29573, M = 139968;
function rand(max) {
last = (last * A + C) % M;
return max * last / M;
}
var ALU =
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
var IUB = {
a:0.27, c:0.12, g:0.12, t:0.27,
B:0.02, D:0.02, H:0.02, K:0.02,
M:0.02, N:0.02, R:0.02, S:0.02,
V:0.02, W:0.02, Y:0.02
}
var HomoSap = {
a: 0.3029549426680,
c: 0.1979883004921,
g: 0.1975473066391,
t: 0.3015094502008
}
function makeCumulative(table) {
var last = null;
for (var c in table) {
if (last) table[c] += table[last];
last = c;
}
}
function fastaRepeat(n, seq) {
var seqi = 0, lenOut = 60;
while (n>0) {
if (n<lenOut) lenOut = n;
if (seqi + lenOut < seq.length) {
ret = seq.substring(seqi, seqi+lenOut);
seqi += lenOut;
} else {
var s = seq.substring(seqi);
seqi = lenOut - s.length;
ret = s + seq.substring(0, seqi);
}
n -= lenOut;
}
}
function fastaRandom(n, table) {
var line = new Array(60);
makeCumulative(table);
while (n>0) {
if (n<line.length) line = new Array(n);
for (var i=0; i<line.length; i++) {
var r = rand(1);
for (var c in table) {
if (r < table[c]) {
line[i] = c;
break;
}
}
}
ret = line.join('');
n -= line.length;
}
}
window.onload = function(){ startTest("sunspider-string-fasta", '');
var ret;
var n = 16;
test( "Homo sapiens alu", function(){
ret = fastaRepeat(4*n*10000, ALU);
});
test( "IUB ambiguity codes", function(){
ret = fastaRandom(3*n*100, IUB);
});
test( "Homo sapiens frequency", function(){
ret = fastaRandom(5*n*100, HomoSap);
});
endTest(); };
</script>
</head>
<body></body>
</html>